Skip to main content
Addgene

pGP-pcDNA3.1 Puro-CAG-Voltron2-ST
(Plasmid #172910)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172910 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Voltron2-ST
  • Alt name
    Voltron2-ST insert
  • Alt name
    variant 476.4495
  • Species
    Synthetic
  • Insert Size (bp)
    1854
  • Mutation
    A122D
  • Promoter CAG
  • Tag / Fusion Protein
    • soma localization targeting sequence (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
  • 3′ sequencing primer TTAAAGCAGCGTATCCACAT
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2021.11.09.467909 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGP-pcDNA3.1 Puro-CAG-Voltron2-ST was a gift from GENIE Project (Addgene plasmid # 172910 ; http://n2t.net/addgene:172910 ; RRID:Addgene_172910)

  • For your References section:

    Sensitivity optimization of a rhodopsin-based fluorescent voltage indicator. Abdelfattah AS, Zheng J, Singh A, Huang YC, Reep D, Tsegaye G, Tsang A, Arthur BJ, Rehorova M, Olson CVL, Shuai Y, Zhang L, Fu TM, Milkie DE, Moya MV, Weber TD, Lemire AL, Baker CA, Falco N, Zheng Q, Grimm JB, Yip MC, Walpita D, Chase M, Campagnola L, Murphy GJ, Wong AM, Forest CR, Mertz J, Economo MN, Turner GC, Koyama M, Lin BJ, Betzig E, Novak O, Lavis LD, Svoboda K, Korff W, Chen TW, Schreiter ER, Hasseman JP, Kolb I. Neuron. 2023 Mar 28:S0896-6273(23)00205-2. doi: 10.1016/j.neuron.2023.03.009. 10.1016/j.neuron.2023.03.009 PubMed 37015225
Related items:
Commonly requested with: