pGP-AAV-syn-FLEX-Ace2N-4AA-mNeon-ST A122D WPRE
(Plasmid #172908)

• Purpose: AAV-mediated expression of voltage sensor under the Syn promoter, Cre-dependent expression; soma localization targeting sequence
• Depositing Lab: GENIE Project
• Publication: Abdelfattah et al Neuron. 2023 Mar 28:S0896-6273(23)00205-2. doi: 10.1016/j.neuron.2023.03.009.

Backbone

• Vector backbone: pAAV-Syn-FLEX
• Backbone manufacturer: Scott Sternson
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Ace2N-4AA-mNeon-ST A122D
• Alt name: Ace2N-4AA-mNeon-ST insert
• Alt name: variant 576.6
• Species: Synthetic
• Insert Size (bp): 1728
• Mutation: A122D
• Promoter: hSynapsin1
• Tag / Fusion Protein:
  • soma localization targeting sequence (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: ACCACGCGAGGCGCGAGATAG
• 3′ sequencing primer: TTAAAGCAGCGTATCCACAT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2021.11.09.467909 for bioRxiv preprint.

Information for AAV1 (Catalog # 172908-AAV1)

Purpose

Ready-to-use AAV1 particles produced from pGP-AAV-syn-FLEX-Ace2N-4AA-mNeon-ST A122D WPRE (#172908). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-Ace2N-4AA-mNeon-ST A122D WPRE plasmid DNA.

Syn-driven, Cre-dependent Ace2N-4AA-mNeon-ST A122D expression. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 7×10¹² vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
• Buffer: PBS + 0.001% Poloxamer 188 + 200 mM NaCl
• Serotype: AAV1
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: mNeon (Cre-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.