Skip to main content
Addgene

pLenti TMEM30A
(Plasmid #171789)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171789 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    lentiviral transferplasmid
  • Backbone manufacturer
    Didier Trono
  • Backbone size w/o insert (bp) 11849
  • Total vector size (bp) 13007
  • Vector type
    Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TMEM30A
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_018247
  • Entrez Gene
    TMEM30A (a.k.a. C6orf67, CDC50A)
  • Promoter CMV
  • Tag / Fusion Protein
    • 6X His + Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAGACCTTGCATTCCTTTGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti TMEM30A was a gift from Veerle Baekelandt (Addgene plasmid # 171789 ; http://n2t.net/addgene:171789 ; RRID:Addgene_171789)

  • For your References section:

    Mutated ATP10B increases Parkinson's disease risk by compromising lysosomal glucosylceramide export. Martin S, Smolders S, Van den Haute C, Heeman B, van Veen S, Crosiers D, Beletchi I, Verstraeten A, Gossye H, Gelders G, Pals P, Hamouda NN, Engelborghs S, Martin JJ, Eggermont J, De Deyn PP, Cras P, Baekelandt V, Vangheluwe P, Van Broeckhoven C. Acta Neuropathol. 2020 Jun;139(6):1001-1024. doi: 10.1007/s00401-020-02145-7. Epub 2020 Mar 14. 10.1007/s00401-020-02145-7 PubMed 32172343
Related items:
Commonly requested with: