pGREAT2
(Plasmid #170890)

• Purpose: GoldenBraid Double Transcriptional Unit - p35SoTMV_E-Luc_NOSt+pNOS_Red-F_NOSt
• Depositing Lab: Markita Landry
• Publication: Gonzalez-Grandio et al ACS Synth Biol. 2021 Sep 14. doi: 10.1021/acssynbio.1c00248.

Backbone

• Vector backbone: pDGB1_omega1
• Backbone manufacturer: Diego Orzaez Lab
• Backbone size w/o insert (bp): 2925
• Vector type: Plant Expression, Luciferase, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: E-Luc
• Alt name: Enhanced beetle luciferase
• Species: Pyrearinus termitilluminans (E-Luc) and Luciola curciata (Red-F)
• Insert Size (bp): 5019
• Mutation: c.375C>T silent mutation to remove BbsI site (E-Luc), p.S286Y Red mutant (RedF)
• Promoter: p35SoTMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Esp3I (destroyed during cloning)
• 3′ cloning site: Esp3I (destroyed during cloning)
• 5′ sequencing primer: GGGAAACGCCTGGTATCTTT
• 3′ sequencing primer: CCGATCCCCGGAATTAGATC

Resource Information

• Supplemental Documents:
  • pGREAT2.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Encodes both E-Luc and Red-F transcriptional units. Insert can be excised by BsaI digestion. Requires pSOUP for replication in agrobacterium . Please visit https://www.biorxiv.org/content/10.1101/2021.05.26.443018v2 to read the preprint on bioRxiv