Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

slc1a3b:myrGCaMP6s-P2A-H2AmCherry
(Plasmid #170209)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170209 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pT2A
  • Backbone size w/o insert (bp) 3299
  • Total vector size (bp) 15921
  • Vector type
    Zebrafish

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    slc1a3b
  • Alt name
    Glast
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    9550
  • Entrez Gene
    slc1a3b (a.k.a. EAAT, gla, si:dkey-21n12.2)
  • Promoter slc1a3b
  • Tag / Fusion Protein
    • myrGCaMP6s-P2A-H2AmCherry (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATTAACCCTCACTAAAGGGA
  • 3′ sequencing primer CCCTATAGTGAGTCGTATTAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    slc1a3b:myrGCaMP6s-P2A-H2AmCherry was a gift from Kelly Monk (Addgene plasmid # 170209 ; http://n2t.net/addgene:170209 ; RRID:Addgene_170209)
  • For your References section:

    Live-imaging of astrocyte morphogenesis and function in zebrafish neural circuits. Chen J, Poskanzer KE, Freeman MR, Monk KR. Nat Neurosci. 2020 Oct;23(10):1297-1306. doi: 10.1038/s41593-020-0703-x. Epub 2020 Sep 7. 10.1038/s41593-020-0703-x PubMed 32895565