Circular 200,100 (RAB7A)
(Plasmid #170118)

• Purpose: AAV vector carrying a guide RNA targeting the human RAB7A mRNA
• Depositing Lab: Prashant Mali
• Publication: Katrekar et al Nat Biotechnol. 2022 Feb 10. pii: 10.1038/s41587-021-01171-4. doi: 10.1038/s41587-021-01171-4.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAV
• Backbone manufacturer: Custom
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 6300
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Circular 200,100 guide RNA
• gRNA/shRNA sequence: GCCATCAGTCGCCGGTCCCAAGCCCGGATAAAATGGGAGGGGGCGGGAAACCGCCTAACCATGCCGACTGATGGCAGAAAAAAAAAAAGACAGTTGTCCCCCTGGAGAGATGAAAAGCTTGTTGGCTCTTAAGTCTTtgataaaaggcgtacataattcttgtgtctactgtacagaatactgccgccagctggatttcccaattctgagtaacactctgcaatccaaacagggttcAACCCTCCACCTTACAGGCCTGCATTACAGGACTTAAACACATAATCCAAAAAAAAAAAACTGCCATCAGTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACGC
• Species: H. sapiens (human)
• Entrez Gene: RAB7A (a.k.a. CMT2B, PRO2706, RAB7)
• Promoter: Human U6

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GACTATCATATGCTTACCGT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry