PdnaK GFP pZa
(Plasmid
#170073)
-
PurposeGFP expression under the control of E. coli dnaK promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170073 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepZa
- Backbone size w/o insert (bp) 2051
- Total vector size (bp) 2768
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGreen fluorescent protein
-
Alt nameGFP
-
SpeciesBacteria
-
Insert Size (bp)717
- Promoter PdnaK
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TACGCCCGGTAGTGATCTTAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PdnaK GFP pZa was a gift from Urartu Seker (Addgene plasmid # 170073 ; http://n2t.net/addgene:170073 ; RRID:Addgene_170073) -
For your References section:
Genetic Circuits To Detect Nanomaterial Triggered Toxicity through Engineered Heat Shock Response Mechanism. Saltepe B, Bozkurt EU, Haciosmanoglu N, Seker UOS. ACS Synth Biol. 2019 Oct 18;8(10):2404-2417. doi: 10.1021/acssynbio.9b00291. Epub 2019 Oct 2. 10.1021/acssynbio.9b00291 PubMed 31536326