Skip to main content
Addgene

pET11a_His-TEV-PLpro (nsp3) (SARS-CoV-2)
(Plasmid #169192)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169192 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET11a
  • Total vector size (bp) 6634
  • Vector type
    Unspecified

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    6His-TEV-nsp3_E746-K1060 (pp1ab_E1564-K1878)
  • Alt name
    His-TEV-PLpro
  • Alt name
    SARS-CoV-2 Papain-like protease
  • Species
    Synthetic; SARS-CoV-2
  • Mutation
    Codon optimised for E. coli
  • Entrez Gene
    ORF1ab (a.k.a. GU280_gp01)
  • Promoter T7
  • Tag / Fusion Protein
    • 6His-TEV (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGCGACTCCTGCATTAG
  • 3′ sequencing primer TCCTTTCGGGCTTTGTTAGCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET11a_His-TEV-PLpro (nsp3) (SARS-CoV-2) was a gift from John Diffley (Addgene plasmid # 169192 ; http://n2t.net/addgene:169192 ; RRID:Addgene_169192)
  • For your References section:

    Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of Nsp3 papain-like protease. Lim CT, Tan KW, Wu M, Ulferts R, Armstrong LA, Ozono E, Drury LS, Milligan JC, Zeisner TU, Zeng J, Weissmann F, Canal B, Bineva-Todd G, Howell M, O'Reilly N, Beale R, Kulathu Y, Labib K, Diffley JFX. Biochem J. 2021 Jul 16;478(13):2517-2531. doi: 10.1042/BCJ20210244. 10.1042/BCJ20210244 PubMed 34198325