Skip to main content
Addgene

pK27Sumo_His-SUMO-nsp10-nsp16 fusion (SARS-CoV-2)
(Plasmid #169191)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169191 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pK27SUMO
  • Total vector size (bp) 5620
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    T5 promoter inducible with IPTG
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    14His-SUMO-nsp10-GSGSGS-nsp16
  • Alt name
    nsp10-16 fusion protein
  • Alt name
    SARS-CoV-2 nsp16/nsp10 CAP methyltransferase
  • Species
    Synthetic; SARS-CoV-2
  • Mutation
    Codon optimised for E. coli
  • GenBank ID
  • Entrez Gene
    ORF1ab (a.k.a. GU280_gp01)
  • Promoter T5
  • Tags / Fusion Proteins
    • 14His-SUMO (N terminal on backbone)
    • Fusion protein of SARS-CoV-2 nsp10 and nsp16 with GSGSGS linker

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAAGCTGATCAGACCCCTGA
  • 3′ sequencing primer CCAGATGGAGTTCTGAGGTC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pK27Sumo_His-SUMO-nsp10-nsp16 fusion (SARS-CoV-2) was a gift from John Diffley (Addgene plasmid # 169191 ; http://n2t.net/addgene:169191 ; RRID:Addgene_169191)

  • For your References section:

    Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of Nsp14 RNA cap methyltransferase. Basu S, Mak T, Ulferts R, Wu M, Deegan T, Fujisawa R, Tan KW, Lim CT, Basier C, Canal B, Curran JF, Drury LS, McClure AW, Roberts EL, Weissmann F, Zeisner TU, Beale R, Cowling VH, Howell M, Labib K, Diffley JFX. Biochem J. 2021 Jul 16;478(13):2481-2497. doi: 10.1042/BCJ20210219. 10.1042/BCJ20210219 PubMed 34198328
Related items:
Commonly requested with: