pGEX-2T-GST-RNMT
(Plasmid #112709)

• Purpose: Expresses N-terminally GST-tagged human RNMT in bacterial cells
• Depositing Lab: Daniel Schoenberg
• Publication: Trotman et al Nucleic Acids Res. 2017 Oct 13;45(18):10726-10739. doi: 10.1093/nar/gkx801.

Backbone

• Vector backbone: pGEX-2T
• Backbone manufacturer: GE Healthcare
• Backbone size w/o insert (bp): 4948
• Total vector size (bp): 6377
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Grow in BL21(DE3) cells for protein overexpression
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: RNMT
• Alt name: RNA guanine-7 methyltransferase
• Alt name: Cap methyltransferase
• Species: H. sapiens (human)
• Insert Size (bp): 1430
• Entrez Gene: RNMT (a.k.a. CMT1, CMT1c, MET, Met, N7-MTase, RG7MT1, cm1p, hCMT1, hMet)
• Tags / Fusion Proteins:
  • GST (N terminal on backbone)
  • thrombin cleavage site

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (destroyed during cloning)
• 5′ sequencing primer: pGEX-F (CCCATCCTGACTTCATGTTGTATGACGC)
• 3′ sequencing primer: pGEX-R (CGCTACGTGACTGGGTCATGG)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Source of RNMT sequence: pET16b-His-RNMT from Stuart Shuman, Sloan Kettering

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry