pGEX-2T-GST-RNMT
(Plasmid
#112709)
-
PurposeExpresses N-terminally GST-tagged human RNMT in bacterial cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112709 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX-2T
-
Backbone manufacturerGE Healthcare
- Backbone size w/o insert (bp) 4948
- Total vector size (bp) 6377
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrow in BL21(DE3) cells for protein overexpression
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRNMT
-
Alt nameRNA guanine-7 methyltransferase
-
Alt nameCap methyltransferase
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1430
-
Entrez GeneRNMT (a.k.a. CMT1, CMT1c, MET, Met, N7-MTase, RG7MT1, cm1p, hCMT1, hMet)
-
Tags
/ Fusion Proteins
- GST (N terminal on backbone)
- thrombin cleavage site
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer pGEX-F (CCCATCCTGACTTCATGTTGTATGACGC)
- 3′ sequencing primer pGEX-R (CGCTACGTGACTGGGTCATGG) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySource of RNMT sequence: pET16b-His-RNMT from Stuart Shuman, Sloan Kettering
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-2T-GST-RNMT was a gift from Daniel Schoenberg (Addgene plasmid # 112709 ; http://n2t.net/addgene:112709 ; RRID:Addgene_112709) -
For your References section:
RNA guanine-7 methyltransferase catalyzes the methylation of cytoplasmically recapped RNAs. Trotman JB, Giltmier AJ, Mukherjee C, Schoenberg DR. Nucleic Acids Res. 2017 Oct 13;45(18):10726-10739. doi: 10.1093/nar/gkx801. 10.1093/nar/gkx801 PubMed 28981715