6xHis-TEV-mCherry-LC3B-Gly (Microtubule-associated proteins 1A/1B light chain 3B)
(Plasmid #169168)

• Purpose: Conjugatable form of LC3B lacking 5 C-terminal amino acids (MKLSV), with C-terminal Glycine120 exposed for lipidation reaction.
• Depositing Lab: Sascha Martens
• Publication: Zaffagnini et al EMBO J. 2018 Mar 1;37(5). pii: embj.201798308. doi: 10.15252/embj.201798308. Epub 2018 Jan 17.

Backbone

• Vector backbone: pETDuet1
• Backbone manufacturer: Merck
• Backbone size w/o insert (bp): 5420
• Total vector size (bp): 6518
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MAP1LC3B
• Alt name: LC3B; ATG8F; MAP1LC3B-a; MAP1A/1BLC3
• Species: H. sapiens (human)
• Insert Size (bp): 1138
• GenBank ID: 81631 NC_000016.10
• Entrez Gene: MAP1LC3B (a.k.a. ATG8F, LC3B, MAP1A/1BLC3, MAP1LC3B-a)
• Promoter: T7 lac promoter
• Tag / Fusion Protein:
  • 6X Histidine Tag, TEV cleavage site, mCherry (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH1 (not destroyed)
• 3′ cloning site: Notl (not destroyed)
• 5′ sequencing primer: GTGAGCAAGGGCGAGGAG
• 3′ sequencing primer: CCCGAACGTCTCCTGGGAGGC

Resource Information

• Supplemental Documents:
  • pET-(His)-TEV-mCherry-LC3B.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Internal construct reference: SMC-948