Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-DIO-EF1α-mKate2-biPAC
(Plasmid #169127)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169127 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-DIO-EF1a
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mKate2-biPAC
  • Species
    Beggiatoa sp. IS2
  • Insert Size (bp)
    1806
  • Mutation
    codon optimized to mouse
  • GenBank ID
  • Promoter EF1a
  • Tag / Fusion Protein
    • mKate2 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer ccagaggttgattatcgataagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

the Boston Children's Hospital viral core made the AAVs for this plasmid, the virus can be requested there.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-DIO-EF1α-mKate2-biPAC was a gift from Georg Nagel (Addgene plasmid # 169127 ; http://n2t.net/addgene:169127 ; RRID:Addgene_169127)
  • For your References section:

    Hypothalamic dopamine neurons motivate mating through persistent cAMP signalling. Zhang SX, Lutas A, Yang S, Diaz A, Fluhr H, Nagel G, Gao S, Andermann ML. Nature. 2021 Sep;597(7875):245-249. doi: 10.1038/s41586-021-03845-0. Epub 2021 Aug 25. 10.1038/s41586-021-03845-0 PubMed 34433964