-
PurposeExpression of PPARA driven by CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169019 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDNA3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 6809
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman ppara
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1420
-
Entrez GenePPARA (a.k.a. NR1C1, PPAR, PPAR-alpha, PPARalpha, hPPAR)
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA3.1-PPARA was a gift from Claes Wadelius (Addgene plasmid # 169019 ; http://n2t.net/addgene:169019 ; RRID:Addgene_169019) -
For your References section:
Multifaceted regulation of hepatic lipid metabolism by YY1. Pan G, Diamanti K, Cavalli M, Lara Gutierrez A, Komorowski J, Wadelius C. Life Sci Alliance. 2021 Jun 7;4(7). pii: 4/7/e202000928. doi: 10.26508/lsa.202000928. Print 2021 Jul. 10.26508/lsa.202000928 PubMed 34099540