Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBLADE(FP6**)-mCherry
(Plasmid #168049)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 168049 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBAD33
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Blue light-inducible AraC dimers in Escherichia coli
  • Alt name
    BLADE
  • Species
    Synthetic
  • Insert Size (bp)
    828
  • Promoter J23101**

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    mCherry
  • Species
    Discosoma sp.
  • Insert Size (bp)
    708
  • Promoter PBAD

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site HindIII (destroyed during cloning)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer CTGATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBLADE(FP6**)-mCherry was a gift from Barbara Di Ventura (Addgene plasmid # 168049 ; http://n2t.net/addgene:168049 ; RRID:Addgene_168049)
  • For your References section:

    Engineering AraC to make it responsive to light instead of arabinose. Romano E, Baumschlager A, Akmeric EB, Palanisamy N, Houmani M, Schmidt G, Ozturk MA, Ernst L, Khammash M, Di Ventura B. Nat Chem Biol. 2021 Apr 26. pii: 10.1038/s41589-021-00787-6. doi: 10.1038/s41589-021-00787-6. 10.1038/s41589-021-00787-6 PubMed 33903769