pBLADE(FP6**)-mCherry
(Plasmid #168049)

• Purpose: Expresses the synthetic gene BLADE FP6 under the constitutive J23101** promoter. mCherry expression is controlled by the PBAD promoter.
• Depositing Lab: Barbara Di Ventura
• Publication: Romano et al Nat Chem Biol. 2021 Apr 26. pii: 10.1038/s41589-021-00787-6. doi: 10.1038/s41589-021-00787-6.

Backbone

• Vector backbone: pBAD33
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Blue light-inducible AraC dimers in Escherichia coli
• Alt name: BLADE
• Species: Synthetic
• Insert Size (bp): 828
• Promoter: J23101**

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCCCCATCGGTGATGTC

Gene/Insert 2

• Gene/Insert name: mCherry
• Species: Discosoma sp.
• Insert Size (bp): 708
• Promoter: PBAD

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: HindIII (destroyed during cloning)
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC
• 3′ sequencing primer: CTGATTTAATCTGTATCAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry