pDawn-sfGFP
(Plasmid #107741)

• Purpose: Expresses superfolder GFP under the control of a blue-light transcriptional regulator
• Depositing Lab: Ingmar Riedel-Kruse
• Publication: Jin et al Proc Natl Acad Sci U S A. 2018 Apr 3;115(14):3698-3703. doi: 10.1073/pnas.1720676115. Epub 2018 Mar 19.

Backbone

• Vector backbone: pDawn
• Backbone manufacturer: Andreas Moeglich Lab
• Backbone size w/o insert (bp): 7173
• Total vector size (bp): 7917
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: superfolder GFP
• Species: Synthetic
• Insert Size (bp): 744
• Promoter: pLambda

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: ctctggcggtgataatggttgc
• 3′ sequencing primer: GAGCCCCCGATTTAGAGC

Resource Information

• Supplemental Documents:
  • pDawn-sfGFP.gb
• A portion of this plasmid was derived from a plasmid made by: Sebastian Schmidl, Jeff Tabor Lab
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry