-
PurposeDoxycycline-inducible Cas9 expression tracked by EGFP fluorescence marker.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167928 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCW-Cas9
-
Backbone manufacturerEric Lander, David Sabatini (Addgene Plasmid #50661)
- Backbone size w/o insert (bp) 11885
- Total vector size (bp) 12674
-
Modifications to backboneReplacing the FseI-BamHI fragment in the backbone with the T2A-EGFP fragment.
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameT2A-EGFP
-
Insert Size (bp)856
- Promoter tTRE, hPGK
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer 5'- AGCTCGTTTAGTGAACCGTCAGATC -3'
- 3′ sequencing primer 5'- GAACGGACGTGAAGAATGTG -3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW-Cas9-2A-EGFP was a gift from Ronald Germain (Addgene plasmid # 167928 ; http://n2t.net/addgene:167928 ; RRID:Addgene_167928) -
For your References section:
Efficient Immune Cell Genome Engineering with Enhanced CRISPR Editing Tools. Chan W, Gottschalk RA, Yao Y, Pomerantz JL, Germain RN. Immunohorizons. 2021 Feb 23;5(2):117-132. doi: 10.4049/immunohorizons.2000082. 10.4049/immunohorizons.2000082 PubMed 33622708
