pCas9
(Plasmid #167547)

• Purpose: Used for CRISPR-Cas9 mediated recomineering in Enterococcus. Can clone desired gRNA using BsaI digestion.
• Depositing Lab: Howard Hang
• Publication: Chen et al Appl Environ Microbiol. 2021 Jul 7:AEM0084421. doi: 10.1128/AEM.00844-21.

Backbone

• Vector backbone: pVPL3004
• Backbone manufacturer: Jan-Peter van Pijkeren
• Backbone size w/o insert (bp): 9747
• Total vector size (bp): 10249
• Modifications to backbone: Erythromycin resistance was swapped for Chloramphenicol via chloramphenicol acetyl transferase. pUC19 origin or replication was inserted.
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 12.5 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: chloramphenicol acetyl transferase
• Alt name: cat
• Insert Size (bp): 651

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTGAAGTTAAATTAGATGCT

Gene/Insert 2

• Gene/Insert name: pUC19 origin of replication
• Alt name: ori
• Insert Size (bp): 589

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGTCGCTTTTGTAAATTTG

Resource Information

• Supplemental Documents:
  • pcas9.gb
  • pCas9 plasmid map
• A portion of this plasmid was derived from a plasmid made by: pUC19 origin of replication was cloned from pUC19 obtained from New England Biolabs. Chloramphenicol acetyltransferase was cloned from pKH12, a gift from Kelli Palmer.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2020.09.01.278044v2 for BioRxiv preprint.