pFGAMS-mCherry
(Plasmid #166024)

• Purpose: Expresses human PFAS-mCherry fusion in mammalian cells
• Depositing Lab: Stephen Benkovic
• Publication: Doigneaux et al J Biol Chem. 2020 Jul 10;295(28):9551-9566. doi: 10.1074/jbc.RA119.012175. Epub 2020 May 21.

Backbone

• Vector backbone: pCI-neo
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 5472
• Total vector size (bp): 10214
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PFAS-mCherry
• Alt name: FGAMS-mCherry
• Species: H. sapiens (human)
• Insert Size (bp): 4776
• Entrez Gene: PFAS (a.k.a. FGAMS, FGAR-AT, FGARAT, GATD8, PURL)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry