SnFR-gamma2
(Plasmid
#165495)
-
PurposeGreen fluorescent glutamate reporter fused to TARP gamma-2 for mammalian expression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165495 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA 3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5460
- Total vector size (bp) 8340
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiGluSnFR extracellular domain fused to Stargazin (gamma-2) via NETO2 TM domain
-
Alt namecacng2
-
SpeciesR. norvegicus (rat), Synthetic
-
Insert Size (bp)2880
-
Entrez GeneCacng2 (a.k.a. Ipr328)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySusumu Tomita, Roger Nicoll, Lorin Looger
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Chimera of iGluSnFR (Addgene plasmid # 41732), Neto2 and Gamma-2 (Stargazin).
Please visit https://doi.org/10.1101/2021.01.21.427382 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SnFR-gamma2 was a gift from Andrew Plested (Addgene plasmid # 165495 ; http://n2t.net/addgene:165495 ; RRID:Addgene_165495) -
For your References section:
Targeted sensors for glutamatergic neurotransmission. Hao Y, Toulme E, Konig B, Rosenmund C, Plested AJR. Elife. 2023 Jan 9;12:e84029. doi: 10.7554/eLife.84029. 10.7554/eLife.84029 PubMed 36622100