SnFR-gamma8
(Plasmid #165496)

• Purpose: Green fluorescent glutamate reporter fused to TARP gamma-8 for mammalian expression.
• Depositing Lab: Andrew Plested
• Publication: Hao et al Elife. 2023 Jan 9;12:e84029. doi: 10.7554/eLife.84029.

Backbone

• Vector backbone: pcDNA 3.1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5460
• Total vector size (bp): 8622
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: iGluSnFR extracellular domain fused to gamma-8 via NETO2 TM domain
• Alt name: cacng8
• Species: R. norvegicus (rat), Synthetic
• Insert Size (bp): 3162
• Entrez Gene: Cacng8
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BmgBI (unknown if destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: AACCGTATTCCACTGCTGC
• 3′ sequencing primer: CAACAGATGGCTGGCAACTA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Susumu Tomita, Roger Nicoll, Lorin Looger

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Chimera of iGluSnFR (Addgene plasmid # 41732), Neto2 and Gamma-8.

Please visit https://doi.org/10.1101/2021.01.21.427382 for bioRxiv preprint.