pGEM-HE-Glyco-Venus-bPAC(S27A)
(Plasmid #165490)

• Purpose: Xenopus oocyte expression of a photoactivatable adenylyl cyclase derived from bPAC using glycophorin for anchoring to the membrane with reduced dark activity
• Depositing Lab: Thomas Oertner
• Publication: Yang et al BMC Biol. 2021 Oct 18;19(1):227. doi: 10.1186/s12915-021-01151-9.

Backbone

• Vector backbone: pGEM HE
• Backbone size w/o insert (bp): 3009
• Total vector size (bp): 5301
• Modifications to backbone: pGEM-HE is a derivative of pGEM3Z vector(Promega) modified after Liman, E.R., Tytgat, J. & Hess,P.; Neuron 9, 1992
• Vector type: Bacterial Expression ; cDNA expression, Xenopus Oocyte

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Glyco-Venus-bPAC(S27A)-Myc
• Alt name: Glyco-Venus-bPAC(S27A)
• Species: Synthetic; Beggiatoa
• Insert Size (bp): 2292
• Promoter: T7
• Tags / Fusion Proteins:
  • Myc (C terminal on insert)
  • Venus (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: gaattaattcgagctcggtac
• 3′ sequencing primer: gtgtaagttggtattatgtag

Resource Information

• Supplemental Documents:
  • pGEM HE-Glyco-Venus-bPAC(S27A)-Myc.gb
• A portion of this plasmid was derived from a plasmid made by: Plasmid was assembled in the lab of Georg Nagel

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry