MSCV-Tox-IRES-eGFP
(Plasmid
#165427)
-
PurposeExpresses TOX in mammalian cells
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165427 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMSCV-IRES-eGFP
-
Backbone manufacturerTannishtha Reya Lab
- Backbone size w/o insert (bp) 6441
- Total vector size (bp) 8100
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTOX
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1656
-
GenBank IDNM_145711
-
Entrez GeneTox (a.k.a. 1700007F02Rik)
- Promoter 5' LTR
-
Tag
/ Fusion Protein
- 3xflag 5' of Tox (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCCCGTCTCTCCCCCTTGAAC
- 3′ sequencing primer GCCAAAAGACGGCAATATGGTGGAAAATAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-Tox-IRES-eGFP was a gift from Patrick Hogan & Anjana Rao (Addgene plasmid # 165427 ; http://n2t.net/addgene:165427 ; RRID:Addgene_165427) -
For your References section:
TOX and TOX2 transcription factors cooperate with NR4A transcription factors to impose CD8(+) T cell exhaustion. Seo H, Chen J, Gonzalez-Avalos E, Samaniego-Castruita D, Das A, Wang YH, Lopez-Moyado IF, Georges RO, Zhang W, Onodera A, Wu CJ, Lu LF, Hogan PG, Bhandoola A, Rao A. Proc Natl Acad Sci U S A. 2019 Jun 18;116(25):12410-12415. doi: 10.1073/pnas.1905675116. Epub 2019 May 31. 10.1073/pnas.1905675116 PubMed 31152140