Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

MSCV-Tox2-IRES-eGFP
(Plasmid #165428)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 165428 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MSCV-IRES-eGFP
  • Backbone manufacturer
    Tannishtha Reya Lab
  • Backbone size w/o insert (bp) 6400
  • Total vector size (bp) 8088
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TOX2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1644
  • GenBank ID
    NP_001092269
  • Entrez Gene
    Tox2 (a.k.a. AI851523, AV026525, BI987407, Gcx1, RxHMG, RxHMG1)
  • Promoter 5' LTR
  • Tag / Fusion Protein
    • 3xflag 5' of Tox2 (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCCCGTCTCTCCCCCTTGAAC
  • 3′ sequencing primer GCCAAAAGACGGCAATATGGTGGAAAATAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-Tox2-IRES-eGFP was a gift from Patrick Hogan & Anjana Rao (Addgene plasmid # 165428 ; http://n2t.net/addgene:165428 ; RRID:Addgene_165428)
  • For your References section:

    TOX and TOX2 transcription factors cooperate with NR4A transcription factors to impose CD8(+) T cell exhaustion. Seo H, Chen J, Gonzalez-Avalos E, Samaniego-Castruita D, Das A, Wang YH, Lopez-Moyado IF, Georges RO, Zhang W, Onodera A, Wu CJ, Lu LF, Hogan PG, Bhandoola A, Rao A. Proc Natl Acad Sci U S A. 2019 Jun 18;116(25):12410-12415. doi: 10.1073/pnas.1905675116. Epub 2019 May 31. 10.1073/pnas.1905675116 PubMed 31152140