Vg4-Luc
(Plasmid
#16501)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 16501 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL3
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5010
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMad-binding element from Vg
-
Tag
/ Fusion Protein
- luciferase (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer n/a
- 3′ sequencing primer LucNrev (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Four copies of the Mad-binding element from Vg (GCTTGGACTGCCGTCGCGATTC) are cloned into pGL3.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Vg4-Luc was a gift from Bert Vogelstein (Addgene plasmid # 16501 ; http://n2t.net/addgene:16501 ; RRID:Addgene_16501) -
For your References section:
Human Smad3 and Smad4 are sequence-specific transcription activators. Zawel L, Dai JL, Buckhaults P, Zhou S, Kinzler KW, Vogelstein B, Kern SE. Mol Cell. 1998 Mar . 1(4):611-7. 10.1016/S1097-2765(00)80061-1 PubMed 9660945
Map uploaded by the depositor.