Skip to main content
Addgene

p276 eSpCas9_2gRNAs_hH11
(Plasmid #164850)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164850 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    eSpCas9(1.1) Addgene #71814
  • Backbone manufacturer
    eSpCas9(1.1) Addgene #71814
  • Total vector size (bp) 8936
  • Vector type
    Mammalian Expression
  • Selectable markers
    None

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNAs for targeting human H11 locus
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI and BsaI (destroyed during cloning)
  • 3′ cloning site BbsI and BsaI (destroyed during cloning)
  • 5′ sequencing primer cgtgacgtagaaagtaataatt
  • 3′ sequencing primer gtccctattggcgttactat
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Additional gRNA block was cut and cloned from Addgene #64073 pX333 into Addgene #71814 eSpCas9(1.1) using restriction enzimes XbaI and KpnI

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p276 eSpCas9_2gRNAs_hH11 was a gift from Philip Jordan (Addgene plasmid # 164850 ; http://n2t.net/addgene:164850 ; RRID:Addgene_164850)

  • For your References section:

    Adaptation of Human Testicular Niche Cells for Pluripotent Stem Cell and Testis Development Research. Pryzhkova MV, Jordan PW. Tissue Eng Regen Med. 2020 Apr;17(2):223-235. doi: 10.1007/s13770-020-00240-0. Epub 2020 Feb 29. 10.1007/s13770-020-00240-0 PubMed 32114677
Related items:
Commonly requested with: