Addgene: pU6-sgRNA EF1Alpha-puro-T2A-BFP.ERH1 Skip to main content
Addgene

pU6-sgRNA EF1Alpha-puro-T2A-BFP.ERH1
(Plasmid #164800)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164800 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pU6-sgRNA EF1Alpha-puro-T2A-BFP
  • Backbone manufacturer
    Jonathan Weissman (Addgene plasmid # 60955)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    ERH CRISPRi gRNA1
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstXI (not destroyed)
  • 3′ cloning site BlpI (not destroyed)
  • 5′ sequencing primer CGACTCGGTGCCACTTTTTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    puro-T2A-BFP
  • Promoter EF1Alpha

Cloning Information for Gene/Insert 2

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-sgRNA EF1Alpha-puro-T2A-BFP.ERH1 was a gift from David Bartel (Addgene plasmid # 164800 ; http://n2t.net/addgene:164800 ; RRID:Addgene_164800)
  • For your References section:

    MicroRNA Clustering Assists Processing of Suboptimal MicroRNA Hairpins through the Action of the ERH Protein. Fang W, Bartel DP. Mol Cell. 2020 Apr 16;78(2):289-302.e6. doi: 10.1016/j.molcel.2020.01.026. 10.1016/j.molcel.2020.01.026 PubMed 32302541