AAV-Best1-sCD200
(Plasmid #164424)

• Purpose: AAV plasmid expressing soluble CD200 in retinal pigment epithelium
• Depositing Lab: Connie Cepko
• Publication: Wang et al Proc Natl Acad Sci U S A. 2019 May 14;116(20):10140-10149. doi: 10.1073/pnas.1901787116. Epub 2019 Apr 29.

Backbone

• Vector backbone: AAV-MCS8
• Backbone manufacturer: Jeng-Shin Lee, Harvard University
• Backbone size w/o insert (bp): 4768
• Total vector size (bp): 5502
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: CD200
• Alt name: Cluster of Differentiation 200
• Alt name: OX-2 membrane glycoprotein
• Species: M. musculus (mouse)
• Insert Size (bp): 734
• Mutation: deleted terminal 40 amino acids
• Entrez Gene: Cd200 (a.k.a. Mox, Mox2, OX, OX2)
• Promoter: Best1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: gttgtaatccagcctgccta
• 3′ sequencing primer: gtcccagtacccttccagga

Resource Information

• Supplemental Documents:
  • AAV-Best1-sCD200.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry