Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLJM60-FLAG NUFIP1
(Plasmid #110950)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 110950 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLJM60
  • Backbone size w/o insert (bp) 11000
  • Total vector size (bp) 12000
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NUFIP1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1500
  • GenBank ID
    NM_012345.2
  • Entrez Gene
    NUFIP1 (a.k.a. NUFIP, Rsa1, bA540M5.1)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJM60-FLAG NUFIP1 was a gift from David Sabatini (Addgene plasmid # 110950 ; http://n2t.net/addgene:110950 ; RRID:Addgene_110950)
  • For your References section:

    NUFIP1 is a ribosome receptor for starvation-induced ribophagy. Wyant GA, Abu-Remaileh M, Frenkel EM, Laqtom NN, Dharamdasani V, Lewis CA, Chan SH, Heinze I, Ori A, Sabatini DM. Science. 2018 May 18;360(6390):751-758. doi: 10.1126/science.aar2663. Epub 2018 Apr 26. 10.1126/science.aar2663 PubMed 29700228