AAV-hRedOpsin-fCX3CL1
(Plasmid #164421)

• Purpose: AAV plasmid expressing full-length CX3CL1 (fractalkine) in photoreceptors
• Depositing Lab: Connie Cepko
• Publication: Wang et al Proc Natl Acad Sci U S A. 2019 May 14;116(20):10140-10149. doi: 10.1073/pnas.1901787116. Epub 2019 Apr 29.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAV-MCS8
• Backbone manufacturer: Jeng-Shin Lee, Harvard University
• Backbone size w/o insert (bp): 6062
• Total vector size (bp): 7267
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cx3cl1
• Alt name: fractalkine
• Alt name: neurotactin
• Alt name: C-X3-C Motif Chemokine Ligand 1
• Species: M. musculus (mouse)
• Insert Size (bp): 1205
• Entrez Gene: Cx3cl1 (a.k.a. AB030188, ABCD-3, AI848747, CX3C, Cxc3, D8Bwg0439e, Scyd, Scyd1, fract, neuro)
• Promoter: human red opsin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: gatctagctcctgggctgag
• 3′ sequencing primer: gctcttgggaagtccccatg

Resource Information

• Supplemental Documents:
  • AAV-hRO-fCX3CL1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry