pMTP130 (pTA106_TnsABC(Tn6900))
(Plasmid
#164261)
-
PurposeVector expressing the TnsA, TnsB, and TnsC transposition proteins from the Tn6900 derivative element with a lactose promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164261 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTA106
- Backbone size w/o insert (bp) 4217
- Total vector size (bp) 7347
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nametnsA, tnsB, and tnsC from Tn6900 derivative from A. salmonicida S44 pS44-1
-
SpeciesAeromonas salmonicida
-
Insert Size (bp)3522
-
Mutation(tnsA) Changed Alanine 125 to Aspartic acid
-
GenBank IDNZ_CP022176.1
- Promoter Lactose
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GCGCCCAATACGCAAACCGCCTCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pSC101 replicon
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMTP130 (pTA106_TnsABC(Tn6900)) was a gift from Joseph Peters (Addgene plasmid # 164261 ; http://n2t.net/addgene:164261 ; RRID:Addgene_164261) -
For your References section:
Guide RNA Categorization Enables Target Site Choice in Tn7-CRISPR-Cas Transposons. Petassi MT, Hsieh SC, Peters JE. Cell. 2020 Nov 30. pii: S0092-8674(20)31464-1. doi: 10.1016/j.cell.2020.11.005. 10.1016/j.cell.2020.11.005 PubMed 33271061