SOX2-P2A-tagBFP-HDR
(Plasmid #163751)

• Purpose: HDR knock-in template for tagging the human endogenous SOX2 gene with a tagBFP fluorescent marker linked by a self-cleaving P2A peptide.
• Depositing Lab: Jennifer Mitchell
• Publication: Abatti et al Nucleic Acids Res. 2023 Sep 22:gkad734. doi: 10.1093/nar/gkad734.

Backbone

• Vector backbone: pJET1.2
• Backbone manufacturer: Thermo Scientific CloneJET
• Backbone size w/o insert (bp): 2974
• Total vector size (bp): 5507
• Vector type: CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SOX2
• Alt name: ANOP3
• Species: H. sapiens (human)
• Insert Size (bp): 2847
• Mutation: Does not contain start codon to avoid random integration and expression
• Entrez Gene: SOX2 (a.k.a. ANOP3, MCOPS3)
• Tag / Fusion Protein:
  • P2A-tagBFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (destroyed during cloning)
• 3′ cloning site: EcoRV (destroyed during cloning)
• 5′ sequencing primer: CGACTCACTATAGGGAGAGCGGC
• 3′ sequencing primer: AAGAACATCGATTTTCCATGGCAG

Resource Information

• Supplemental Documents:
  • SOX2-P2A-tagBFP-HDR.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

HDR knock-in template for tagging the human endogenous SOX2 gene with tagBFP (402nm/457nm). Contains the SOX2 coding sequence without a start codon to avoid random integration and sequencing. C-terminal P2A-tagBFP tag induces expression of tagBFP together with SOX2, but these two proteins are self-cleaved and separated during translation. SOX2 HDR cassette is surrounded by sgRNA target sequences to allow linearization inside the cell. Use this construct together with Addgene #163752 gRNA.