nuc-mCherry-pTRIP
(Plasmid #163520)

• Purpose: Used to construct lentivirus to express nucleus-targeted mCherry in mammalian cells
• Depositing Lab: Thomas Weber
• Publication: Expression plasmid for production of murine IFN gamma (unpublished)

Backbone

• Vector backbone: pTRIP-Puro-2A
• Backbone manufacturer: Addgene
• Modifications to backbone: Multiple cloning sites added.
• Vector type: Mammalian Expression, Bacterial Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: nucleus targeted mCherry
• Species: Synthetic
• Insert Size (bp): 904

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xba1 (unknown if destroyed)
• 3′ cloning site: BamH1 (unknown if destroyed)
• 5′ sequencing primer: TTTGGCAGTACACCAATGGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Created by Ananda Mookerjee and Thomas Weber.
Contains SV40 Large T NLS (3X) at the N-terminal of mCherry (in frame) and a cMyc NLS at the C-terminal of mCherry