pLJM1-zeo-UL32
(Plasmid
#162664)
-
PurposeLentiviral vector for stable expression of UL32 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162664 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLJM1
- Backbone size w/o insert (bp) 7034
- Total vector size (bp) 8825
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUL32
-
SpeciesHSV-1
-
Insert Size (bp)1791
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer ggatctctgctgtccctgtaataaacc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJM1-zeo-UL32 was a gift from Britt Glaunsinger (Addgene plasmid # 162664 ; http://n2t.net/addgene:162664 ; RRID:Addgene_162664) -
For your References section:
A pentameric protein ring with novel architecture is required for herpesviral packaging. Didychuk AL, Gates SN, Gardner MR, Strong LM, Martin A, Glaunsinger BA. Elife. 2021 Feb 8;10. pii: 62261. doi: 10.7554/eLife.62261. 10.7554/eLife.62261 PubMed 33554858