pUE1-TSP-ORF68 K435A
(Plasmid
#162651)
-
PurposeExpresses ORF68 K435A in mammalian cells with an N-terminal TwinStrep tag and HRV 3C protease cleavage site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162651 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHEK293 Ultra Expression Vector I
-
Backbone manufacturerTakara
- Backbone size w/o insert (bp) 4632
- Total vector size (bp) 6033
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameORF68
-
SpeciesKSHV (HHV-8)
-
Insert Size (bp)1401
-
MutationAmino acid K435 mutated to alanine
- Promoter CMV
-
Tag
/ Fusion Protein
- N-terminal 2xStrep-Tag II and HRV 3C site (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GTCAAGAAGACAGGGCCAGGTTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUE1-TSP-ORF68 K435A was a gift from Britt Glaunsinger (Addgene plasmid # 162651 ; http://n2t.net/addgene:162651 ; RRID:Addgene_162651) -
For your References section:
A pentameric protein ring with novel architecture is required for herpesviral packaging. Didychuk AL, Gates SN, Gardner MR, Strong LM, Martin A, Glaunsinger BA. Elife. 2021 Feb 8;10. pii: 62261. doi: 10.7554/eLife.62261. 10.7554/eLife.62261 PubMed 33554858