pPPED
(Plasmid #162468)

• Purpose: Destination Expression vector for dicot plant prime editing
• Depositing Lab: Adam Bogdanove
• Publication: Wang et al Front Genome Ed. 2021 Mar 4;3:617553. doi: 10.3389/fgeed.2021.617553. eCollection 2021.

Backbone

• Vector backbone: p201N Cas9
• Backbone size w/o insert (bp): 14349
• Total vector size (bp): 18330
• Vector type: Plant Expression
• Selectable markers: kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Kanamycin, 25 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Cas9H840A
• Species: Synthetic
• Insert Size (bp): 10576
• Mutation: Change histidine 840 to Alanine based sequence on vector pMOD_A0301
• Promoter: 2x35S
• Tag / Fusion Protein:
  • MLV reverse transcriptase (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTAAGGGATGACGCACAATCC
• 3′ sequencing primer: ttcgaattcactgccgtc

Gene/Insert 2

• Gene/Insert name: attR gateway destination cassette
• Species: Synthetic

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCAACTGACTGAAATGCCTCA
• 3′ sequencing primer: acatcaggttaatggcgt

Resource Information

• Supplemental Documents:
  • pPPED.gb
• A portion of this plasmid was derived from a plasmid made by: Dr. Ning Zhang from Dr. Gregory Martin lab made this vector.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Reference:
1) Targeted genome modifications in soybean with CRISPR/Cas9. Jacobs TB, LaFayette PR, Schmitz RJ, Parrott WA. BMC Biotechnology. 2015;15:16
2) A Multipurpose Toolkit to Enable Advanced Genome Engineering in Plants. Cermak, T.
Curtin, S. J., Gil-Humanes, J., Cegan, R., Kono, T. J. Y., Konecna, E., Belanto, J. J., Starker, C. G., Mathre, J. W., Greenstein, R. L., Voytas, D. F. Plant Cell. 2017; 29(6):1196-1217.
Please visit https://www.biorxiv.org/content/10.1101/2020.07.16.206276v1 for bioRxiv preprint.