modified pcAT7-Glo1
(Plasmid #160996)

• Purpose: Splicing reporter backbone
• Depositing Lab: Brenton Graveley
• Publication: Adamson et al Genome Biol. 2018 Jun 1;19(1):71. doi: 10.1186/s13059-018-1437-x.

Backbone

• Vector backbone: pCAGGS
• Backbone size w/o insert (bp): 5000
• Total vector size (bp): 6955
• Vector type: Mammalian Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hemoglobin subunit beta
• Alt name: HBB
• Species: H. sapiens (human)
• Insert Size (bp): 1600
• Mutation: Repeated intron 1 with 40 nucelotide deletion
• GenBank ID: NM_000518
• Entrez Gene: HBB (a.k.a. CD113t-C, ECYT6, beta-globin)
• Promoter: CAG

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pAT7-Glo1_delta_spC_consensus.gb
• A portion of this plasmid was derived from a plasmid made by: The original version of this plasmid was received from Kristen Lynch at University of Pennsylvania. A 40 bp deletion in intron 1 was made in intron 1 compared to the original pcAT7-Glo1.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cloning for initial Vex-seq inserts is between the PstI and XbaI sites. The second step for generating the final splicing reporter involves PCR amplifying intron 2 and exon 3 from modified pcAT7-Glo1 using GTGTGGAAGTCTCAGGATCG and AACGGGCCCTCTAGAGC and digesting with XbaI and MfeI.