plko-shmfn2-mfn2-Rescue
(Plasmid
#160655)
-
Purpose"Rescue mfn2 expression by adding the guide-resistant-mutant mfn2 sequence"
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160655 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepLKO.1 lentiviral backbone
- Total vector size (bp) 8500
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemfn2
-
Alt namemitofusin 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2274
-
Entrez GeneMFN2 (a.k.a. CMT2A, CMT2A2, CMT2A2A, CMT2A2B, CPRP1, HMSN6A, HSG, MARF, MSL)
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CAAGTGTATTGTGAAGAGATGCGTGAAGAGCGGCAAG
- 3′ sequencing primer TTCACAATACACTTGTTGCTCCCGAGCCGCCATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plko-shmfn2-mfn2-Rescue was a gift from Qing Deng (Addgene plasmid # 160655 ; http://n2t.net/addgene:160655 ; RRID:Addgene_160655) -
For your References section:
Mitofusin 2 regulates neutrophil adhesive migration and the actin cytoskeleton. Zhou W, Hsu AY, Wang Y, Syahirah R, Wang T, Jeffries J, Wang X, Mohammad H, Seleem MN, Umulis D, Deng Q. J Cell Sci. 2020 Sep 4;133(17). pii: jcs.248880. doi: 10.1242/jcs.248880. 10.1242/jcs.248880 PubMed 32788232
