plko-shmfn2-mito-GFP-ER tethering
(Plasmid
#160509)
-
PurposeRescue mfn2 knockdown by tethering mitochondria and ER with GFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160509 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1 lentiviral backbone
-
Backbone manufacturersigma MISSION
- Backbone size w/o insert (bp) 8500
-
Modifications to backboneGFP was removed from the backbone (MFN2-sh2: TRCN0000082687) and the tether rescue construct was inserted.
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemito-GFP-ER tethering
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1274
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTCCCGGTCGCCACC ATGGCAATCCAGTTGCGTTCG
- 3′ sequencing primer TCGAGGTCGAGAATT TTA AGATACATTGATGAGTTTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypLKO.1 lentiviral constructs with shRNA (TRCN0000082687) was from MILLIPORE SIGMA.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The mitochondria-GFP-ER tether construct was published. The GFP containing a mitochondria localization signal (ATGGCAATCCAGTTGCGTTCGCTCTTCCCCTTGGCATTGCCCGGAATGCTGGCCCTCCTTGGCTGGTGGTGGTTTTTCTCTCGTAAAAAA) and ER localization signal (ATGGTTTATATTGGCATCGCTATTTTTTTGTTTTTGGTGGGCCTGTTTATGAAA) at it N- and C- terminal respectively.
1. Kornmann, B. et al. An ER-mitochondria tethering complex revealed by a synthetic biology screen. Science (80-. ). 325, 477–481 (2009).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plko-shmfn2-mito-GFP-ER tethering was a gift from Qing Deng (Addgene plasmid # 160509 ; http://n2t.net/addgene:160509 ; RRID:Addgene_160509) -
For your References section:
Mitofusin 2 regulates neutrophil adhesive migration and the actin cytoskeleton. Zhou W, Hsu AY, Wang Y, Syahirah R, Wang T, Jeffries J, Wang X, Mohammad H, Seleem MN, Umulis D, Deng Q. J Cell Sci. 2020 Sep 4;133(17). pii: jcs.248880. doi: 10.1242/jcs.248880. 10.1242/jcs.248880 PubMed 32788232