Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

MIGR1-CD5
(Plasmid #159329)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159329 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    MIGR1
  • Vector type
    Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD5
  • Alt name
    Lyt-1
  • Alt name
    Ly1
  • Alt name
    12507
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1485
  • GenBank ID
    NM_007650.3
  • Entrez Gene
    Cd5 (a.k.a. Ly-1, Ly-A, Ly-12, Lyt-1)
  • Promoter LTR

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GCATTCCTTTGGCGAGAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Derived from Addgene plasmid 27490 MIGR1 from Dr. Warren Pear's lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MIGR1-CD5 was a gift from Nevil Singh (Addgene plasmid # 159329 ; http://n2t.net/addgene:159329 ; RRID:Addgene_159329)
  • For your References section:

    CD5 dynamically calibrates basal NF-kappaB signaling in T cells during thymic development and peripheral activation. Matson CA, Choi S, Livak F, Zhao B, Mitra A, Love PE, Singh NJ. Proc Natl Acad Sci U S A. 2020 Jun 23;117(25):14342-14353. doi: 10.1073/pnas.1922525117. Epub 2020 Jun 8. 10.1073/pnas.1922525117 PubMed 32513716