pX330-gRNA
(Plasmid #158973)

• Purpose: A human codon-optimized SpCas9 and chimeric guide RNA (gRNA3) expression plasmid.
• Depositing Lab: Charles P. Lai
• Publication: Chien et al Nucleic Acids Res. 2020 Aug 14. pii: 5892751. doi: 10.1093/nar/gkaa669.

Backbone

• Vector backbone: pX330-U6-Chimeric_BB-CBh-hSpCas9
• Total vector size (bp): 8509
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: gRNA3
• Alt name: pX330-gRNA
• Species: Synthetic
• Insert Size (bp): 21
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bbs-I (destroyed during cloning)
• 3′ cloning site: Bbs-I (destroyed during cloning)
• 5′ sequencing primer: GAGGGCCTATTTCCCATGATTCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The plasmid was generated from Addgene Plasmid #42230 by cloning gRNA3 into the pX330 backbone.
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry