elavl3:SomaGCaMP7f
(Plasmid
#158760)
-
PurposeCell body-targeted GCaMP7f, under HuC promoter: GCaMP7f followed by a linker, and the EE-RR coiled coil motif (GCaMP7f-27-EE-RR). As bright as conventional GCaMP7f.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 158760 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePZ0
- Backbone size w/o insert (bp) 12509
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSomaGCaMP7
-
Alt nameGCaMP7F
-
Alt nameGCaMP7
-
SpeciesSynthetic
-
Insert Size (bp)1710
- Promoter HuC promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tatccctctcagacgcattg
- 3′ sequencing primer TCCAAACTCATCAATGTATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
elavl3:SomaGCaMP7f was a gift from Edward Boyden (Addgene plasmid # 158760 ; http://n2t.net/addgene:158760 ; RRID:Addgene_158760) -
For your References section:
Precision Calcium Imaging of Dense Neural Populations via a Cell-Body-Targeted Calcium Indicator. Shemesh OA, Linghu C, Piatkevich KD, Goodwin D, Celiker OT, Gritton HJ, Romano MF, Gao R, Yu CJ, Tseng HA, Bensussen S, Narayan S, Yang CT, Freifeld L, Siciliano CA, Gupta I, Wang J, Pak N, Yoon YG, Ullmann JFP, Guner-Ataman B, Noamany H, Sheinkopf ZR, Park WM, Asano S, Keating AE, Trimmer JS, Reimer J, Tolias AS, Bear MF, Tye KM, Han X, Ahrens MB, Boyden ES. Neuron. 2020 Jun 26. pii: S0896-6273(20)30398-6. doi: 10.1016/j.neuron.2020.05.029. 10.1016/j.neuron.2020.05.029 PubMed 32592656