Skip to main content
Addgene

pLenti-hSyn-Gαi*-BERKY3
(Plasmid #158428)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158428 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti-hSynapsin-Cre-WPRE (Addgene Plasmid #86641)
  • Backbone size w/o insert (bp) 9434
  • Total vector size (bp) 11642
  • Modifications to backbone
    AgeI-Cre-EcoRI removed during cloning
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lyn11-Nluc-ER/K linker-3xYFP-KB1753-myc
  • Alt name
    Gai*-BERKY3
  • Insert Size (bp)
    3189
  • Promoter hSynapsin
  • Tag / Fusion Protein
    • Myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI, replaced with NheI/GCCACC (destroyed during cloning)
  • 3′ cloning site EcoRI, replaced with XbaI/AgeI (destroyed during cloning)
  • 5′ sequencing primer gcagcggaggagtcgtgtcg
  • 3′ sequencing primer ccacatagcgtaaaaggagc
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-hSyn-Gαi*-BERKY3 was a gift from Mikel Garcia-Marcos (Addgene plasmid # 158428 ; http://n2t.net/addgene:158428 ; RRID:Addgene_158428)
  • For your References section:

    Revealing the Activity of Trimeric G-proteins in Live Cells with a Versatile Biosensor Design. Maziarz M, Park JC, Leyme A, Marivin A, Garcia-Lopez A, Patel PP, Garcia-Marcos M. Cell. 2020 Jun 27. pii: S0092-8674(20)30752-2. doi: 10.1016/j.cell.2020.06.020. 10.1016/j.cell.2020.06.020 PubMed 32634377