pCaggs-mGold
(Plasmid #157996)

• Purpose: Expression of mGold in mammalian cells
• Depositing Lab: Francois St-Pierre
• Publication: Lee et al Sci Adv. 2020 Oct 23;6(43). pii: 6/43/eabb7438. doi: 10.1126/sciadv.abb7438. Print 2020 Oct.

Backbone

• Vector backbone: pCaggs
• Backbone size w/o insert (bp): 6105
• Total vector size (bp): 6825
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mGold
• Alt name: mVenus(L46F;T63S)
• Species: Synthetic
• Insert Size (bp): 720
• Mutation: mGold is mVenus with L46F;T63S mutations
• Promoter: Actin promoter with CMV enhancer

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: HindIII (unknown if destroyed)
• 5′ sequencing primer: aaggtggtggctggtgtggc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the mVenus annotation in the plasmid map is incorrect, as this plasmid encodes mGold.