pMAH-POLY-eRF1(E55D)
(Plasmid #157925)

• Purpose: Encodes a polyspecific aminoacyl-tRNA synthetase fused to a modified releasing factor and four copies of amber suppression tRNAs for unnatural amino acid incorporation in mammalian cells
• Depositing Lab: Huiwang Ai
• Publication: Chen et al Cell Chem Biol. 2021 Jan 27. pii: S2451-9456(21)00013-1. doi: 10.1016/j.chembiol.2021.01.013.

Backbone

• Vector backbone: pMAH
• Backbone size w/o insert (bp): 7583
• Total vector size (bp): 10256
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: POLY-eRF1(E55D), Polyspecific aminoacyl-tRNA Synthetase fused to a modified releasing factor through 2A peptide
• Insert Size (bp): 2673
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACA CAT ACG ATT TAG GTG ACA CTA TAG AAT
• 3′ sequencing primer: ATGAAAGCCATACGGGAAGCAATAGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid can be used in mammalian cells to genetically encode an array of para-substituted phenylalanine analogs, including p-boronophenylalaine (pBoF), p-azidophenylalanine (pAzF), p-acetylphenylalanine (pAcF), p-iodophenylalanine (pIoF), p-bromophenylalanine (pBrF), p-cyanophenylalanine (pCNF), p-nitrophenylalanine (pNO2F), p-benzoylphenylalanine (pBzF), 4,4′-biphenylalanine (BIF), O-methyl-tyrosine (OMeY), O-propargyl-tyrosine (OPrY), and O-allyl-tyrosine.