pBAD-pnGFP-Ultra
(Plasmid
#157923)
-
PurposePeroxynitrite sensor pnGFP-Ultra in E. coli (use with pEvol-BoF)
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 157923 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepBAD
- Backbone size w/o insert (bp) 3954
- Total vector size (bp) 4737
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepnGFP-Ultra, a high performance peroxynitrite sensor
-
Insert Size (bp)783
- Promoter araBAD
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAT GCC ATA GCA TTT TTA TCC ATA AGA TTA GC
- 3′ sequencing primer AGTCTTTCGACTGAGCCTTTCGTTTTATT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-pnGFP-Ultra was a gift from Huiwang Ai (Addgene plasmid # 157923 ; http://n2t.net/addgene:157923 ; RRID:Addgene_157923) -
For your References section:
A high-performance genetically encoded fluorescent biosensor for imaging physiological peroxynitrite. Chen Z, Zhang S, Li X, Ai HW. Cell Chem Biol. 2021 Jan 27. pii: S2451-9456(21)00013-1. doi: 10.1016/j.chembiol.2021.01.013. 10.1016/j.chembiol.2021.01.013 PubMed 33581056
