pDendra2-H4
(Plasmid #157815)

• Purpose: Fluorescent reporter for histone H4 tracking
• Depositing Lab: Xin Chen
• Publication: Ma et al Cell Rep. 2020 Aug 11;32(6):108003. doi: 10.1016/j.celrep.2020.108003.

Backbone

• Vector backbone: Dendra2-N1
• Backbone size w/o insert (bp): 4750
• Total vector size (bp): 5018
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: H4
• Alt name: Hist2h4
• Species: M. musculus (mouse)
• Insert Size (bp): 309
• GenBank ID: 97122
• Entrez Gene: H4c14 (a.k.a. H4, H4c1, H4c11, H4c12, H4c2, H4c3, H4c4, H4c6, H4c8, H4c9, H4f16, Hist2h4, X04652)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: N/A

Resource Information

• Supplemental Documents:
  • Chen lab histone-dendra2 plasmids instructions

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry