Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDendra2-H3
(Plasmid #157814)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 157814 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Dendra2-N1
  • Backbone size w/o insert (bp) 4750
  • Total vector size (bp) 5117
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H3
  • Alt name
    Hist1h3a
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    408
  • GenBank ID
    360198
  • Entrez Gene
    H3c1 (a.k.a. H3c10, H3c11, H3c8, Hist1h3a)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer N/A
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDendra2-H3 was a gift from Xin Chen (Addgene plasmid # 157814 ; http://n2t.net/addgene:157814 ; RRID:Addgene_157814)
  • For your References section:

    Differential Histone Distribution Patterns in Induced Asymmetrically Dividing Mouse Embryonic Stem Cells. Ma B, Trieu TJ, Cheng J, Zhou S, Tang Q, Xie J, Liu JL, Zhao K, Habib SJ, Chen X. Cell Rep. 2020 Aug 11;32(6):108003. doi: 10.1016/j.celrep.2020.108003. 10.1016/j.celrep.2020.108003 PubMed 32783931