pSCMV-H2B-FT-Slow
(Plasmid
#157671)
-
PurposeRetroviral vector for expressing chimeric human histone H2B fused with the "Slow" variant of the monomeric color-changing fluorescent timer (FT) in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 157671 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSCMV
-
Backbone manufacturerGuo et al. 2012 (PMC3478612)
- Backbone size w/o insert (bp) 7060
- Total vector size (bp) 8173
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHistone H2B
-
Alt nameH2B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1113
- Promoter CMV
-
Tag
/ Fusion Protein
- Slow-FT (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer attaatacgactcactatagggag
- 3′ sequencing primer tgagggctggataaagggag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCMV-H2B-FT-Slow was a gift from Shangqin Guo (Addgene plasmid # 157671 ; http://n2t.net/addgene:157671 ; RRID:Addgene_157671) -
For your References section:
Resolving Cell Cycle Speed in One Snapshot with a Live-Cell Fluorescent Reporter. Eastman AE, Chen X, Hu X, Hartman AA, Pearlman Morales AM, Yang C, Lu J, Kueh HY, Guo S. Cell Rep. 2020 Jun 23;31(12):107804. doi: 10.1016/j.celrep.2020.107804. 10.1016/j.celrep.2020.107804 PubMed 32579930