Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGL2 p15 4xSBR1 MutSBE
(Plasmid #15718)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 15718 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGL2-E1bTATA
  • Backbone size w/o insert (bp) 5600
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p15 4xSBR1
  • Alt name
    p15INK4b 4xSBR1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    120
  • Mutation
    Mutant SBE (Smad binding element)
  • Entrez Gene
    CDKN2B (a.k.a. CDK4I, INK4B, MTS2, P15, TP15, p15INK4b)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer n/a
  • 3′ sequencing primer LucNRev
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

SBR1 is one of the Smad Binding Regions on the p15INK4b promoter.

Smad binding element sequence - ACTAATTCGGGCAGAAAGACACATCCAAGAGAA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL2 p15 4xSBR1 MutSBE was a gift from Joan Massague (Addgene plasmid # 15718 ; http://n2t.net/addgene:15718 ; RRID:Addgene_15718)
  • For your References section:

    C/EBPbeta at the core of the TGFbeta cytostatic response and its evasion in metastatic breast cancer cells. Gomis RR, Alarcon C, Nadal C, Van Poznak C, Massague J. Cancer Cell. 2006 Sep . 10(3):203-14. 10.1016/j.ccr.2006.07.019 PubMed 16959612