pHR-UCOE-SFFV-dCas9-mCherry-ZIM3-KRAB
(Plasmid #154473)

• Purpose: Expresses dCas9 fused to mCherry and the KRAB domain of ZIM3
• Depositing Lab: Mikko Taipale
• Publication: Alerasool et al Nat Methods. 2020 Nov;17(11):1093-1096. doi: 10.1038/s41592-020-0966-x. Epub 2020 Oct 5.

Backbone

• Vector backbone: pHR-SFFV-dCas9-BFP-KRAB
• Backbone manufacturer: Jonathan Weissman lab (Addgene plasmid #46911)
• Total vector size (bp): 14812
• Modifications to backbone: Replaced BFP with mCherry and KOX1 KRAB domain with ZIM3 KRAB domain
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: mCherry (fused to dCas9)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Grow at 30 degrees to avoid recombination
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ZIM3
• Species: H. sapiens (human)
• Mutation: Includes ZIM3 aa 1-100
• Entrez Gene: ZIM3 (a.k.a. ZNF264, ZNF657)
• Promoter: SFFV
• Tag / Fusion Protein:
  • HA (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATTGATTGACTGCCCACCTC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • UCOE-SFFV-dCas9-mCherry-ZIM3-KRAB.gb
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry